Tenttiwiki

Differences

This shows you the differences between two versions of the page.

Link to this comparison view

Both sides previous revision Previous revision
geenitekniikan_tyoet [2020/06/06 19:58]
37.219.111.124 [Tentti 27.3.2020]
geenitekniikan_tyoet [2020/06/06 19:59] (current)
37.219.111.124 [Tentti 27.3.2020]
Line 10: Line 10:
 2.  Käytössäsi on kaksi kolibakteerin kantaa: villityyppinen ja mutanttikanta. Mutanttikannassa väitetään olevan GT1-geenin keskellä 800 bp deleetio. Villityypissä geeni on kokonainen. Haluat varmistaa deleetion olemassaolon mutanttikannassa käyttämällä Southern blot -tekniikkaa. Kerro lyhyesti (ranskalaiset viivat riittävät),​ mitä työvaiheita suoritat alkaen siitä, kun saat käsiisi villityypin ja mutanttikannan puhdasviljelmät. Olet jo kloonannut valmiiksi plasmidiin kolibakteerista eristetyn villityypin GT1-geenin. (8p) 2.  Käytössäsi on kaksi kolibakteerin kantaa: villityyppinen ja mutanttikanta. Mutanttikannassa väitetään olevan GT1-geenin keskellä 800 bp deleetio. Villityypissä geeni on kokonainen. Haluat varmistaa deleetion olemassaolon mutanttikannassa käyttämällä Southern blot -tekniikkaa. Kerro lyhyesti (ranskalaiset viivat riittävät),​ mitä työvaiheita suoritat alkaen siitä, kun saat käsiisi villityypin ja mutanttikannan puhdasviljelmät. Olet jo kloonannut valmiiksi plasmidiin kolibakteerista eristetyn villityypin GT1-geenin. (8p)
  
-3. Suunnittele 20 nukelotidiä pitkät alukkeet monistaaksesi alla olevan sekvenssin siten, että PCR tuotteen alkuun lisäät translaation aloituskodonia vastaavan sekvenssin ATG. (6p)+3. Suunnittele 20 nukelotidiä pitkät alukkeet monistaaksesi alla olevan sekvenssin siten, että PCR tuotteen alkuun lisäät translaation aloituskodonia vastaavan sekvenssin ATG.
  
 CCGAGAGTGATGTGTAAACCGTCGGATAGTCGTGTACGTGTGTCACACGCAGCTGCGCGCGCGCATCGACG CCGAGAGTGATGTGTAAACCGTCGGATAGTCGTGTACGTGTGTCACACGCAGCTGCGCGCGCGCATCGACG