Tenttiwiki

Differences

This shows you the differences between two versions of the page.

Link to this comparison view

Both sides previous revision Previous revision
Next revision
Previous revision
geenitekniikan_tyoet [2015/05/12 14:12]
128.214.137.52 Tentti 12.5.2015
geenitekniikan_tyoet [2019/06/12 22:35] (current)
Line 1: Line 1:
 +======Geenitekniikan tyot ======
  
 +====Tentti 5.4.2019====
 +
 +1. Selitä lyhyesti (parilla lauseella)
 +a) IPTG:n tehtävä työn 2 proteiinin tuotossa (2p)
 +b) Miksi työ 1:n Southern Blot:issa käytetty koetin denaturoitiin ennen sen lisäämistä hybridisaatioliuokseen (2p)
 +c) Työn 2 ligaatiossa haluttiin vektori:​inserttisuhteeksi 1:2, Miksi vektorimäärän ollessa 100 ng, ei inserttiä kuitenkaan käytetty 200 ng? (2p)
 +
 +2. Suunnittele 20 nukelotidiä pitkät alukkeet monistaaksesi alla olevan sekvenssin siten, että PCR tuotteen alkuun lisäät translaation aloituskodonia vastaavan sekvenssin ATG. (6p)
 +
 +(tässän noin 100 emäsparin sekvenssi)
 +
 +**Forward alukkeen sekvenssi:​**
 +
 +**Reverse alueen sekvenssi:​**
 +
 +3. Alla olevassa kuvassa näkyy pQE-30 vektori jota käytettiin kurssilla. Selitä lyhyesti 5 asiaa, jotka tekevät hyvän tuottovektorin ja merkitse ne kuvaan.
 +
 +{{::​geenitekniikan_tyoet_pqe-30.jpg?​nolink&​400 |}}
 +
 +
 +
 +====Tentti 12.5.2015====
 +
 +Aiheita:
 +
 +  * Kuva elektroforeesigeelistä,​ jossa oli analysoitu kahdella restriktioentsyymillä pilkottuja plasmideja. Piti tulkita kuvista täydellistä ja osittaista digestiota.
 +  * PCR-alukkeiden suunnittelu (mukaan restriktio-saitit) jne. Mitä kaikkea laitat PCR-ajoon menevään putkeen? Suunnittele PCR-ajo.
 +  * Kerro lyhyesti
 +    * (Unohtui jo mikä oli kysymys)
 +    * Membraanin blokkaus (hybridisaation yhteydessä)
 +    * Miksi työssä 2 laitettiin IPTG:tä tuubiin
 +
 +====Uusintatentti 13.11.2012====
 +
 +Tehtäviin vastattiin suoraan kysymyspaperille,​ joten alla vain tehtävien aiheet.
 +
 +   - A. Digestoidun plasmidin agaroosigeeliajokuvan analysointi B. Ligaatioon tarvittavat tilavuudet vektoria ja inserttiä (moolisuhteiden muuntaminen massasuhteiksi)
 +   - Vektoriplasmidin eri osat ja niiden merkitys geenitekniikassa lyhyesti
 +   - A. PCR-alukkeiden suunnittelu B. PCR-ohjelman suunnittelu C. Kloonauksen vaiheet pääpiirteissään
 +   - Sanaselitys
 +
 +
 +
 +
 +
 +
 +
 +
 +
 +
 +====16.10.2012.2012====
 +  - Mitä olennaisia piirteitä löydät kuvan vektorista? Selitä lyhyesti miksi mainitsemasi ominaisuudet ovat tarpeellisia ko. vektoria käytettäessä (**3p**) (kuva 1)
 +  - Haluat kloonata oheisen sekvenssin esittämän geenin pQE30-vektoriin ilman oman ribosomin sitoutumiskohtaansa siten, että syntyvä proteiini tehdään __samassa lukukehyksessä__ kuin vektorin koodaamat histidiinit (Kuva 2.)
 +    - Suunnittele alukkeet, joilla suoritat kloonauksen. Kirjoita alukkeiden sekvenssit 5' -> 3'. Osoita kumpaan juosteeseen alukkeet pariutuvat sekä polymeraasin lukusuunta. Alukkeiden T<​sub>​M</​sub>:​n tulisi olla 1. PCR-syklissä n 55-60 ˚C. Ohje T<​sub>​M</​sub>​= (4 x (G+C))+ (2x (A+T))˚C, jossa (G+C) on G- ja C-nukleotidien ja (A+T) A- ja T-nukleotidien lukumäärä alukkeessa. Lisäksi tarvitset alukkeisiin sellaiset restriktioentsyymin katkaisukohdat,​ joilla voit liittää PCR:llä monistetun DNA-palan vektroiin oikeassa orientaatiossa. Käytät kloonauksessa restriktioentsyymien SphI (GCATGC) ja SalI (GTCGAC) katkaisukohtia (**4p**)
 +    - Millaisella PCR-ohjelmalla monistat geenin? (**2p**)
 +    - Kerro pääpiirteet siitä, miten suoritat kloonauksen (**3p**)
 +  - Mihin perustuu DNA:n ajautuminen agaroosigeelissä?​ Entä proteiinien erottelu SDS-polyakryyliamidigeelissä (**4p**)
 +  -                                                                                                                                                                                                    ​
 +    - Selitä DIG-leimauksen periaate. Kerro myös mitä komponentteja reaktioseoksen tulee sisältää,​ jotta saat valmistettua kaksijuosteisen DIG-leimatun koettimen (**3p**)
 +    - Olet valmistanut PCR:n avulla kaksijuosteisen DIG-leimatujn koettimen PCR:llä. Samalla teit myös kontrollireaktion käyttäentavallisia nukleotideja. Tulokset ovat ohessa (Kuva 3). Onko leimaus reaktio onnistunut? Perustele vastauksesi (**1p**)
 +
 +kuva 1
 +
 +
 + ​{{gentektyoet_t1.jpg| }}
 +
 +
 +
 +kuva 2
 +
 + ​{{gentektyoet_t2.jpg| }}
 +
 +
 +
 +Kuva 3 (Vasemmalta:​ DIG, kontrolli)
 +
 +{{gentektyoet_t3.jpg| }}
 +
 +====4.6.2008====
 +
 +   - Mitä entsyymiä käytät, kun tahdot
 +     * liittää yhteen kaksi erillistä, samanlaisilla yksijuosteisilla päillä varustettua DNA-fragmenttia?​
 +     * poistaa DNA-fragmentin vapaat 5'​-fosfaatit?​
 +     * katkaista DNA-molekyylin tietystä kohdasta?
 +     * tuottaa yksijuosteiselle DNA:lle vastinjuosteen,​ kun reaktioseoksessa on sopivia alukkeita ja nukleotideja?​ (4p)
 +   - 2700 nukleotidia pitkä kloonausvektori sisältää polylinkkerialueen insertin kloonaamista varten, jossa on restriktioentsyymien tunnistussekvenssejä seuraavassa järjestyksessä:​ //​EcoR1-Sac1-Hind3-Bcl1-BamH1-Sma1-Not1-Bgl2//​. Kloonaat 2000 emäsparin pituisen fragmentin vektorin //​Hind3-BamH1//​ -kohtiin. Alustavassa fragmentin restriktiokartoituksessa teet seuraavat digestiot, joiden tuloksena agaroosigeelielektroforeesissa näkyvät seuraavat fragmenttikoot: ​ EcoR1 4000 + 700 bp, Sac1  3200+1500 bp, Sma1 3600+1100 bp, Not1 4700 bp, Bgl2 2900+1400+400 bp 
 +     * Laadi insertistä mahdollisimman tarkka restriktiokartta. (2p)
 +     * Kartta ei ole tarkka yhden entsyymin kohdalla. Minkälaisen kaksoisdigestion avulla voisit määrittää kyseisen entsyymin katkaisukohdat insertissä?​ Mitkä ovat mahdolliset fragmenttikokojen vaihtoehdot,​ jotka tässä kaksoisdigestiossa voivat syntyä? (2p)
 +   ​- ​
 +     * Olet digestoinut vektoriplasmidin yhdellä restriktioentsyymillä kloonausta varten. Entsyymillä on vain yksi tunnistuskohta vektorissa. Tarkastusgeelissä näet odottamasi yhden raidan sijasta kolme: linearisoidun plasmidin kokoinen raita sekä sitä alempi ja ylempi raita. Miten voit selittää tämän? **(2p)**
 +     * Miksi elektroporaation jälkeen soluja kasvatetaan jonkin aikaa ennen maljaamista selektioalustalle?​ (1p)
 +     * Miksi faagikirjaston seulonta on monesti toistettava ainakin kahdesti? (1p)
 +     * Miksi faagi-DNA denaturoidaan membraanilla ennen hybridisaatiota?​ (1p)
 +     * Miten hybridisaatiossa syntyvää taustaa pyritään vähentämään?​ (2p)
 +     * Miten CSPD liittyy DIG-detektioon?​ (1p)
 +     * Mihin ITPG:tä käytetään rekombinanttiproteiinien tuotossa? (1p)
 +   - Olet eristänyt patogeenisen bakteerin //​Salmonella typhimuriumin//​ adhesiinigeenin ja sekvensoinut sen. Adhesiinin avulla ko. bakteeri kykenee sitoutumaan suolen limakalvoon ja aiheuttamaan infektion. Selitä pääpiirteittäin,​ kuinka lähtisit tutkimaan, mikä osa adhesiiniproteiinista sitoutuu limakalvon kollageeniin?​ (3p)
 +
 +
 +====3.10.2006====
 +
 +  -  ​
 +    * Kuinka kaksijuosteisen DNAn juosteet ovat kiinni toisissaan ja millä keinoilla voit irrottaa juosteet toisistaan? (2p.)
 +    * Miksi lampda-faagikirjaston seulonnassa plakillisia membraaneita pisettiin UV-valossa (tai 80 asteessa)? (1p.)
 +    * Miksi prehybridisaatio tehtiin? Millainen on lopputulos, jos prehybridisaatio epäonnistuu?​ (1p.)
 +    * Miksi kurssilla tehtiin dephosphorylaatio?​ (1p.)
 +  - Ohessa on pSE380-ekspressiovektorin kartta. Haluat koonata PCR-fragmentin ylläolevaan vektoriin EcoRV-NheI-kohtaan. Kuvaa lyhyesti kloonauksen vaiheet. (3p.)
 +  - Alla on esimerkki PCR-ohjelmasta. Selitä lyhyesti mitä eri vaiheissa tapahtuu. (2p.)
 +  - Olet suunnittelemassa PCR-alukkeita,​ joiden avulla pystyt monistamaan tietyn geenin koodaavan jakson ja luomaan ​ PCR-tuotteen päihin restriktioentsyymien tunnistuskohdat,​ jotta voisit kloonata geenin ekspressiovektoriin. Olet suunnitellu 5'​-pään (Forward-) alukkeen, jonka laskennallinen Tm=62C. Suunnittele aluke siten, että PCR-tuotteeseen muodostuu //​Bam//​HI-tunnistuskohta (GGATCC) välittömästi translaation lopetuskodonin (__TAA__) jälkeen. Ilmoita alukkeen 5'​-3'​-suunnassa. (2p.
 +
 +   ​5'​-CCCACGCGCCCCATTTACCGCATCGGCTTGCGATCACTG__TAA__CAGGCAATCCGAT-3'​
 +       ​P ​ T  R  P  F  T  A  S  A  C  D  H  S
 +
 +
 +====23.9.2004====
 +
 +Vastaa kaikkiin kysymyksiin konseptipaperille. Vastaa lyhyesti ja ytimekkäästi!
 +  - Olet kloonannut lituruohon (//​Arabidopsis thaliana//) stressinkestävyyteen liittyvän geenin, ERD15, mRNA:ta vastaavan cDNA:n. Nyt haluat tuottaa ERD15-proteiinia. Suunnittele tätä varten alukkeet, jolla saat monistettua cDNA:sta proteiinia koodaavan sekvenssin (sekvenssi ohessa). Lisää alukkeisiin sellaiset restriktioentsyymien katkaisukohdat,​ joilla saat tuotteen kloonattua oikeassa orientaatiossa ja lukuraamissa eskpressiovektoriin pExpress (vektorin polylinkkerin sekvenssi alla). Lisäksi laadi PCR-ohjelma sekvenssin monistamiseen,​ kun käytät Pfu-polymeraasia,​ jonka optimilämpötila on 75°C. (6p)
 +{{geenitekniikantyot.jpg}}
 +  - Tutkit koivun (Betula pendula) geenejä, jotka aktivoituvat patogeenisten mikrobien vaikutuksesta. Käyttämällä tällaista kavigeeniä vastaavaa cDNA-koetinta olet kloonannut kolibakteerin DNA-palan, jota aiot tutkia lähemrnjji-DNA-insertti on kuvan mukaisesti (kuva ohessa) liitetty vektoriin, jonka kok on 2700 nukleotidia. Kartoitat valikoituja kloonatun DNA-palan sisältämiä restriktioerksyymin katkaisukohtia yhden ja kahden entsyymin katkaisuilla. Oheisessa taulukossa näkyvät agaroosigeelielektroforeesin perusteella määrittämäsi eri katkaisujen tuottamien DNA-palojen koot. Piirrä tuloksen perusteella rekombinanttiplasmidin restriktiokartta,​ josta selviää käytettyjen entsyymien katkaisukohtien lukumäärä sekä kaikkien kohtien keskinäinen järjestys ja etäisyydet toisistaan. (5p)
 +  - 
 +    * Selitä lyhyesti, miten vähennetään taustaa hybridisaatiossa?​ (2p)
 +    * Selitä lyhyesti, mihin digoksigeniini-leimatun koettimen detektio perustuu? (2p)
 +    * Selitä lyhyesti, miten pQE-30-vektoriin kloonatun fragmentin ekspressio voidaan indusoida. Miksi ekspression säätely on monesti tarpeen? (2p)
 +    * Aiot valmistaa PCR:llä yksijuosteisen,​ DIG-leimatun koettimen. Mitä komponentteja reaktioseoksen tulee sisältää,​ jotta reaktio toimii halutulla tavalla? (2p)
 +
 +
 +====4.11.2003====
 +
 +Vastaa lyhyesti kaikkiin kysymyksiin:​
 +  - 2700 bp kloonausvektorin polylinkkerialueella on insertin kloonaamista varten restriktioentsyymien katkaisukohdat seuraavassa järjestyksessä:​ EcoR1-Sac1-Hind3-Bcl1-BamH1-Sma1-Not1-Bgl2. Kloonaat vektoriin 2000bp pitkän insertin Hind3-BamH1-fragmenttina. Alustavassa restriktiokartoituksessa teet seuraavat digestiot, joilla agaroosigeelielektroforeesin mukaan näyttäisi syntyvän seuraavat fragmentit:
 +
 +   ​EcoR1 ​               4000 + 700 bp \\ 
 +   ​Sad ​                  ​3200+1500 bp \\ 
 +   ​Bell ​                   2900 + 1800 bp \\ 
 +   ​Sma1 ​                ​3600+1100 bp\\ 
 +   ​Not1 ​                  4700 bp\\ 
 +   ​Bgl2 ​                  ​2900+1800 bp\\ 
 +
 +Laadi insertistä mahdollisimman tarkka restriktiokartta. Yhden entsyymin osalta kartta on epätarkka. Suunnittele tarkistusdigestio,​ jonka avulla voit varmistaa kyseisen entsyymin katkaisu-kohdan insertissä?​ Minkäkokoisia fragmentteja digestio voi vaihtoehtoisesti tuottaa? (3p.)
 +  - Olet suunnittelemassa PCR-alukkeita,​ joiden avulla pystyt monistamaan tietyn geenin koodaavan jakson (963 bp) ja luomaan PCR-tuotteen päihin restriktioentsyymien tunnistuskohdat,​ jotta voisit kloonata geenin ekspressiovektoriin. Olet jo suunnitellut 5'​-pään (Forvvard-) alukkeen, jonka laskennallinen Tm = 62°C. Suunnittele oheisen geenin 3'​-pään sekvenssin perusteella sopiva Reverse-aluke. Suunnittele aluke siten, että PCR-tuotteeseen muodostuu öamHI-tunnistuskohta (GGATCC) välittömästi translaation lopetuskodonista (TAA) alavirtaan. Ilmoita alukkeen sekvenssi 5'​-3'​-suunnassa. ​
 +
 +   ​5´CCCACGCGCCCATTTACCGCATCGGCTTGCGATCACTCGJAAGGATTACGG3´ ​    (2p.)
 + 
 +  - Olet digestoinut insertin (1000 bp) ja pBluescript-vektorin (3000 bp) kloonaamista varten. Puhdistuksen jälkeen määrität sekä vektorin että insertin DNA-pitoisuudeksi 50 ng/ul. Käytössäsi olevan ligaasin pitoisuus on 2 U/ul. Kuinka paljon eri reaktiokomponentteja ja reagensseja pipetoit ligaatioreaktioon,​ kun
 +    * Ligaatioreaktiossa käytetään 150 ng vektoria
 +    * lnsertin:​vektorin moolisuhde on 2
 +    * Ligaasia käytetään 1 U
 +    *  Reaktion kokonaistilavuus on 20 mikrolitraa ​ (2p.)
 +  - Selitä lyhyesti:
 +    * Miten alkaalista fosfataasia hyödynnetään DIG-leimatun koettimen kemiluminisenssi-detektiossa?​ (2p.)
 +    * Miten vähennetään koettimesta peräisin olevaa, hybridisaatiossa syntyvää epäspesifistä taustaa? (2p.)
 +    * Laita seuraavat ekspressiovektorin elementit oikeaan järjestykseen:​ His-tag (6Xhis) / Translaation lopetuskodonit / T5 promoottori / Polylinkkeri (MCS) / Ribosomin sitoutumiskohta (RBS) / Lac-operaattori(t) / Translaation aloituskodoni / Transkription lopetussignaali (to) (2p.).
 +    * Joudut tekemään PCR-reaktion alukeparilla,​ joilla on poikkeuksellisen korkea Tm (77°C). Suunnittele alukeparille sopiva PCR-ohjelma (2p.).
 +
 +
 +====25.9.2003====
 +
 +Vastaa lyhyesti kaikkiin kysymyksiin:​
 +  - Haluat ekspressoida tietyn geenin cDNA:ta E.colissa. Olet kloonannut cDNA:n (2000 bp) pUC19-vektoriin H/​ncflll-fragmenttina,​ tehnyt siitä restriktiokartan ja sekvensoinut sen. Insertin restriktiokartoituksen perusteella siitä löytyvät seuraavat restriktioentsyymien katkaisukohdat:​ //(Tässä kohdassa oikeassa elämässä restriktiokohdan yksinkertainen kartta. Sellainen ei kuitenkaan tämän tentin postausvaiheessa taipunut Wikiin. Nyt tilanne on toinen, mutta tentti jossain kaukana...)//​ Seuraavaksi kloonaat cDNA:n H/​ndlll-fragmenttina ekspressiovektoriin (3600bp), jonka polylinkkerialueella on insertin kloonaamista varten restriktioentsyymien katkaisukohdat seuraavassa jarjestyksessa:​ 5'​-BamH\-Hind\\\-Sac\-Kpn\-Sma\-Sal\-EcoR\-3'​.
 +Suunnittele tarkistusdigestio,​ jonka avulla selvität insertin orientaation ekspressiovektorissa. llmoita digestiossa syntyvien fragmenttien koot, mikäli
 +    * insertti on ekspressiovektorissa oikeassa orientaatiossa
 +    * insertti on vektorissa väärässä orientaatiossa (yhteensa 3p)
 +  - Haluat kloonata kasvissa toimivaan ekspressiovektoriin lituruohon (Arabidopsis thaliana) transkriptiofaktorin alayksikön geenin. Päätät eristää geenin genomisesta DNA:sta PCR:n avulla ja samalla luoda PCR-tuotteeseen kloonaamiseen tarvittavat restriktioentsyymien katkaisukohdat. Tutkittuasi oheista geenin sekvenssiä huomaat iloksesi, etta muuttamalla kaksi aloituskodonin viereistä nukleotidia saat luotua Forward-alukkeen 5'​-päähän Ncol-kohdan (CCATGG), jonka avulla pystyt kloonaamaan geenin oikeassa lukukehyksessä ekspressiovektoriin. Reverse-alukkeeseen päätät lisätä Bc/​l-sekvenssin (TGATCA).
 +    * Esitä sekä Forward- että Reverse-alukkeen sekvenssit 5'​-3'​-suunnassa
 +    * Koska joudut suunnittelemaan alukkeet tiettyyn kohtaan sekvenssia, ne eivät välttämättä täytä kaikkia optimaalisen alukeparin vaatimuksia. Selitä lyhyesti, mita teoreettisia ongelmia suunnittelemiisi alukkeisiin liittyy. (yhteensa 4p)
 +  - Faagikirjaston tiitteri on 2.5x10^8 pfu/ml. Minkälaisen laimennoksen tekisit, jotta maljatessasi sitä 100 \i\ saisit noin 500 plakkia maljalle? Selitä laimennoksen tekeminen käytännössä. (2p)
 +  - Selitä lyhyesti: (yhteensa 7p)
 +    * Prehybridisaatio
 +    * Faagikirjaston sekundaariseulonta
 +    * Anti-DIG-AP ja sen käyttö kemiluminisenssidetektiossa
 +    * Dideoksinukleotiditja niiden käyttö sekvensoinnissa
 +    * Restriktioentsyymidigestiossa DNA:han syntyva "​tahmea pää" ("​sticky end")
 +    * IPTG:n käyttö geeniekspression säätelyssa //​E.colissa//​
 +    * Olet digestoinut plasmidin yhdellä restriktioentsyymillä kloonausta varten. Tarkistusgeelissä näet odottamasi linearisoidun plasmidin kokoisen raidan lisäksi sitä alemman ja ylemmän raidan. Miten selität tämän?
 +
 +
 +====30.3.2001====
 +
 +Vastaa kaikkiin kysymyksiin konseptipaperille. Vastaa lyhyesti ja ytimekkaasti!
 +  - Olet eristänyt koivun (//Betula pendula//) cDNA-kirjastosta kylmänkestävyyteen liittyvän geenin käyttäen koettimena lituruohosta (//​Arabidopsis thaliana//) peräisin olevaa EST:ia (Expressed Sequence Tag). Olet onnistunut, yrityksen ja erehdyksen kautta, subkloonaamaan kyseisen cDNA:n (koko 2200 bp) molemmissa orientaatioissa Bluescript-vektoriin. Bluescript (koko 3000 bp) sisältää MCS-kohdan seka sitoutumiskohdat universaalialukkeille. Digestoit molemmissa orientaatioissa olevan plasmidin EcoRl-, HindlH-., Smal- sekä Xhol -restriktioentsyymeilla. Saat seuraavan kokoiset fragmentit:
 +
 +
 +   ​Orientaatio I                         ​Orientaatio II \\ 
 +   ​EcoRl 0,6 kb; 1,3 kb; 3,3 kb Orientaatio II  0,3 kb; 1,3 kb; 3,6 kb\\ 
 +   ​HindLII 1,3 kb; 3,9 kb          ​Orientaatio II  0,9 kb; 4,3 kb\\ 
 +   ​Smal  ​        0,3 kb; 1,2 kb; 3,7 kb Orientaatio II    0,7 kb; 1,2 kb; 3,3 kb\\ 
 +   ​Xhol  ​        ​1,​0kb;​ 4,2kb            Orientaatio II     ​1,​2kb;​ 4,​0kb\\ ​
 +
 +Laadi insertista restriktiokartta. Laadi myos suunnitelma,​ miten sekvensoisit restriktiokarttaasi hyvaksi kayttaen molemmat juosteet koko insertista. (6p)
 +  - Mitä reagensseja pipetoit lineaariseen PCR-reaktioon,​ jolla aiot valmistaa yksijuosteisen,​ DIG-leimatun koettimen? (2p)
 +  - Olet digestoinut vektoriplasmidin yhdellä restriktioentsyymilla kloonausta varten. Entsyymilla on vain yksi tunnistuskohta vektorissa. Tarkastusgeelissä näet odottamasi yhden raidan sijasta kolme: linearisoiden plasmidin kokoinen raita, sekä sitä alempi ja ylempi raita. Miten voit selittaa taman? (2p)
 +  - Selitä lyhyesti seuraavat termit (3p):
 +    * cDNA
 +    * kirjaston tiitteri
 +    * blokkaus
 +  - Olet eristänyt patogeenisen bakteerin Salmonella typhimuriumin adhesiinigeenin ja sekvensoinut sen. Adhesiinin avulla ko. bakteeri kykenee sitoutumaan suolen limakalvoon ja aiheuttamaan infektion. Millä tavoin tutkisit, mikä osa adhesiiniproteiinista sitoutuu limakalvon kollageeniin?​