Warning: Declaration of action_plugin_captcha::register(&$controller) should be compatible with DokuWiki_Action_Plugin::register(Doku_Event_Handler $controller) in /var/www/fs3/43/helixryf/public_html/tenttiwiki/lib/plugins/captcha/action.php on line 0

Warning: Cannot modify header information - headers already sent by (output started at /var/www/fs3/43/helixryf/public_html/tenttiwiki/lib/plugins/captcha/action.php:0) in /var/www/fs3/43/helixryf/public_html/tenttiwiki/inc/auth.php on line 549

Warning: Cannot modify header information - headers already sent by (output started at /var/www/fs3/43/helixryf/public_html/tenttiwiki/lib/plugins/captcha/action.php:0) in /var/www/fs3/43/helixryf/public_html/tenttiwiki/inc/actions.php on line 207
geenitekniikan_tyoet - Tenttiwiki
Tenttiwiki

Geenitekniikan tyot

Tentti 12.5.2015

Aiheita:

  • Kuva elektroforeesigeelistä, jossa oli analysoitu kahdella restriktioentsyymillä pilkottuja plasmideja. Piti tulkita kuvista täydellistä ja osittaista digestiota.
  • PCR-alukkeiden suunnittelu (mukaan restriktio-saitit) jne. Mitä kaikkea laitat PCR-ajoon menevään putkeen? Suunnittele PCR-ajo.
  • Kerro lyhyesti
    • (Unohtui jo mikä oli kysymys)
    • Membraanin blokkaus (hybridisaation yhteydessä)
    • Miksi työssä 2 laitettiin IPTG:tä tuubiin

Uusintatentti 13.11.2012

Tehtäviin vastattiin suoraan kysymyspaperille, joten alla vain tehtävien aiheet.

  1. A. Digestoidun plasmidin agaroosigeeliajokuvan analysointi B. Ligaatioon tarvittavat tilavuudet vektoria ja inserttiä (moolisuhteiden muuntaminen massasuhteiksi)
  2. Vektoriplasmidin eri osat ja niiden merkitys geenitekniikassa lyhyesti
  3. A. PCR-alukkeiden suunnittelu B. PCR-ohjelman suunnittelu C. Kloonauksen vaiheet pääpiirteissään
  4. Sanaselitys

16.10.2012.2012

  1. Mitä olennaisia piirteitä löydät kuvan vektorista? Selitä lyhyesti miksi mainitsemasi ominaisuudet ovat tarpeellisia ko. vektoria käytettäessä (3p) (kuva 1)
  2. Haluat kloonata oheisen sekvenssin esittämän geenin pQE30-vektoriin ilman oman ribosomin sitoutumiskohtaansa siten, että syntyvä proteiini tehdään samassa lukukehyksessä kuin vektorin koodaamat histidiinit (Kuva 2.)
    1. Suunnittele alukkeet, joilla suoritat kloonauksen. Kirjoita alukkeiden sekvenssit 5' → 3'. Osoita kumpaan juosteeseen alukkeet pariutuvat sekä polymeraasin lukusuunta. Alukkeiden TM:n tulisi olla 1. PCR-syklissä n 55-60 ˚C. Ohje TM= (4 x (G+C))+ (2x (A+T))˚C, jossa (G+C) on G- ja C-nukleotidien ja (A+T) A- ja T-nukleotidien lukumäärä alukkeessa. Lisäksi tarvitset alukkeisiin sellaiset restriktioentsyymin katkaisukohdat, joilla voit liittää PCR:llä monistetun DNA-palan vektroiin oikeassa orientaatiossa. Käytät kloonauksessa restriktioentsyymien SphI (GCATGC) ja SalI (GTCGAC) katkaisukohtia (4p)
    2. Millaisella PCR-ohjelmalla monistat geenin? (2p)
    3. Kerro pääpiirteet siitä, miten suoritat kloonauksen (3p)
  3. Mihin perustuu DNA:n ajautuminen agaroosigeelissä? Entä proteiinien erottelu SDS-polyakryyliamidigeelissä (4p)
    1. Selitä DIG-leimauksen periaate. Kerro myös mitä komponentteja reaktioseoksen tulee sisältää, jotta saat valmistettua kaksijuosteisen DIG-leimatun koettimen (3p)
    2. Olet valmistanut PCR:n avulla kaksijuosteisen DIG-leimatujn koettimen PCR:llä. Samalla teit myös kontrollireaktion käyttäentavallisia nukleotideja. Tulokset ovat ohessa (Kuva 3). Onko leimaus reaktio onnistunut? Perustele vastauksesi (1p)

kuva 1

kuva 2

Kuva 3 (Vasemmalta: DIG, kontrolli)

4.6.2008

  1. Mitä entsyymiä käytät, kun tahdot
    • liittää yhteen kaksi erillistä, samanlaisilla yksijuosteisilla päillä varustettua DNA-fragmenttia?
    • poistaa DNA-fragmentin vapaat 5'-fosfaatit?
    • katkaista DNA-molekyylin tietystä kohdasta?
    • tuottaa yksijuosteiselle DNA:lle vastinjuosteen, kun reaktioseoksessa on sopivia alukkeita ja nukleotideja? (4p)
  2. 2700 nukleotidia pitkä kloonausvektori sisältää polylinkkerialueen insertin kloonaamista varten, jossa on restriktioentsyymien tunnistussekvenssejä seuraavassa järjestyksessä: EcoR1-Sac1-Hind3-Bcl1-BamH1-Sma1-Not1-Bgl2. Kloonaat 2000 emäsparin pituisen fragmentin vektorin Hind3-BamH1 -kohtiin. Alustavassa fragmentin restriktiokartoituksessa teet seuraavat digestiot, joiden tuloksena agaroosigeelielektroforeesissa näkyvät seuraavat fragmenttikoot: EcoR1 4000 + 700 bp, Sac1 3200+1500 bp, Sma1 3600+1100 bp, Not1 4700 bp, Bgl2 2900+1400+400 bp
    • Laadi insertistä mahdollisimman tarkka restriktiokartta. (2p)
    • Kartta ei ole tarkka yhden entsyymin kohdalla. Minkälaisen kaksoisdigestion avulla voisit määrittää kyseisen entsyymin katkaisukohdat insertissä? Mitkä ovat mahdolliset fragmenttikokojen vaihtoehdot, jotka tässä kaksoisdigestiossa voivat syntyä? (2p)
    • Olet digestoinut vektoriplasmidin yhdellä restriktioentsyymillä kloonausta varten. Entsyymillä on vain yksi tunnistuskohta vektorissa. Tarkastusgeelissä näet odottamasi yhden raidan sijasta kolme: linearisoidun plasmidin kokoinen raita sekä sitä alempi ja ylempi raita. Miten voit selittää tämän? (2p)
    • Miksi elektroporaation jälkeen soluja kasvatetaan jonkin aikaa ennen maljaamista selektioalustalle? (1p)
    • Miksi faagikirjaston seulonta on monesti toistettava ainakin kahdesti? (1p)
    • Miksi faagi-DNA denaturoidaan membraanilla ennen hybridisaatiota? (1p)
    • Miten hybridisaatiossa syntyvää taustaa pyritään vähentämään? (2p)
    • Miten CSPD liittyy DIG-detektioon? (1p)
    • Mihin ITPG:tä käytetään rekombinanttiproteiinien tuotossa? (1p)
  3. Olet eristänyt patogeenisen bakteerin Salmonella typhimuriumin adhesiinigeenin ja sekvensoinut sen. Adhesiinin avulla ko. bakteeri kykenee sitoutumaan suolen limakalvoon ja aiheuttamaan infektion. Selitä pääpiirteittäin, kuinka lähtisit tutkimaan, mikä osa adhesiiniproteiinista sitoutuu limakalvon kollageeniin? (3p)

3.10.2006

    • Kuinka kaksijuosteisen DNAn juosteet ovat kiinni toisissaan ja millä keinoilla voit irrottaa juosteet toisistaan? (2p.)
    • Miksi lampda-faagikirjaston seulonnassa plakillisia membraaneita pisettiin UV-valossa (tai 80 asteessa)? (1p.)
    • Miksi prehybridisaatio tehtiin? Millainen on lopputulos, jos prehybridisaatio epäonnistuu? (1p.)
    • Miksi kurssilla tehtiin dephosphorylaatio? (1p.)
  1. Ohessa on pSE380-ekspressiovektorin kartta. Haluat koonata PCR-fragmentin ylläolevaan vektoriin EcoRV-NheI-kohtaan. Kuvaa lyhyesti kloonauksen vaiheet. (3p.)
  2. Alla on esimerkki PCR-ohjelmasta. Selitä lyhyesti mitä eri vaiheissa tapahtuu. (2p.)
  3. Olet suunnittelemassa PCR-alukkeita, joiden avulla pystyt monistamaan tietyn geenin koodaavan jakson ja luomaan PCR-tuotteen päihin restriktioentsyymien tunnistuskohdat, jotta voisit kloonata geenin ekspressiovektoriin. Olet suunnitellu 5'-pään (Forward-) alukkeen, jonka laskennallinen Tm=62C. Suunnittele aluke siten, että PCR-tuotteeseen muodostuu BamHI-tunnistuskohta (GGATCC) välittömästi translaation lopetuskodonin (TAA) jälkeen. Ilmoita alukkeen 5'-3'-suunnassa. (2p.
 5'-CCCACGCGCCCCATTTACCGCATCGGCTTGCGATCACTG__TAA__CAGGCAATCCGAT-3'
     P  T  R  P  F  T  A  S  A  C  D  H  S

23.9.2004

Vastaa kaikkiin kysymyksiin konseptipaperille. Vastaa lyhyesti ja ytimekkäästi!

  1. Olet kloonannut lituruohon (Arabidopsis thaliana) stressinkestävyyteen liittyvän geenin, ERD15, mRNA:ta vastaavan cDNA:n. Nyt haluat tuottaa ERD15-proteiinia. Suunnittele tätä varten alukkeet, jolla saat monistettua cDNA:sta proteiinia koodaavan sekvenssin (sekvenssi ohessa). Lisää alukkeisiin sellaiset restriktioentsyymien katkaisukohdat, joilla saat tuotteen kloonattua oikeassa orientaatiossa ja lukuraamissa eskpressiovektoriin pExpress (vektorin polylinkkerin sekvenssi alla). Lisäksi laadi PCR-ohjelma sekvenssin monistamiseen, kun käytät Pfu-polymeraasia, jonka optimilämpötila on 75°C. (6p)

ikPYbOIOOAHGQdUEhOS

  1. Tutkit koivun (Betula pendula) geenejä, jotka aktivoituvat patogeenisten mikrobien vaikutuksesta. Käyttämällä tällaista kavigeeniä vastaavaa cDNA-koetinta olet kloonannut kolibakteerin DNA-palan, jota aiot tutkia lähemrnjji-DNA-insertti on kuvan mukaisesti (kuva ohessa) liitetty vektoriin, jonka kok on 2700 nukleotidia. Kartoitat valikoituja kloonatun DNA-palan sisältämiä restriktioerksyymin katkaisukohtia yhden ja kahden entsyymin katkaisuilla. Oheisessa taulukossa näkyvät agaroosigeelielektroforeesin perusteella määrittämäsi eri katkaisujen tuottamien DNA-palojen koot. Piirrä tuloksen perusteella rekombinanttiplasmidin restriktiokartta, josta selviää käytettyjen entsyymien katkaisukohtien lukumäärä sekä kaikkien kohtien keskinäinen järjestys ja etäisyydet toisistaan. (5p)
    • Selitä lyhyesti, miten vähennetään taustaa hybridisaatiossa? (2p)
    • Selitä lyhyesti, mihin digoksigeniini-leimatun koettimen detektio perustuu? (2p)
    • Selitä lyhyesti, miten pQE-30-vektoriin kloonatun fragmentin ekspressio voidaan indusoida. Miksi ekspression säätely on monesti tarpeen? (2p)
    • Aiot valmistaa PCR:llä yksijuosteisen, DIG-leimatun koettimen. Mitä komponentteja reaktioseoksen tulee sisältää, jotta reaktio toimii halutulla tavalla? (2p)

4.11.2003

Vastaa lyhyesti kaikkiin kysymyksiin:

  1. 2700 bp kloonausvektorin polylinkkerialueella on insertin kloonaamista varten restriktioentsyymien katkaisukohdat seuraavassa järjestyksessä: EcoR1-Sac1-Hind3-Bcl1-BamH1-Sma1-Not1-Bgl2. Kloonaat vektoriin 2000bp pitkän insertin Hind3-BamH1-fragmenttina. Alustavassa restriktiokartoituksessa teet seuraavat digestiot, joilla agaroosigeelielektroforeesin mukaan näyttäisi syntyvän seuraavat fragmentit:
 EcoR1                4000 + 700 bp \\ 
 Sad                   3200+1500 bp \\ 
 Bell                    2900 + 1800 bp \\ 
 Sma1                 3600+1100 bp\\ 
 Not1                   4700 bp\\ 
 Bgl2                   2900+1800 bp\\ 

Laadi insertistä mahdollisimman tarkka restriktiokartta. Yhden entsyymin osalta kartta on epätarkka. Suunnittele tarkistusdigestio, jonka avulla voit varmistaa kyseisen entsyymin katkaisu-kohdan insertissä? Minkäkokoisia fragmentteja digestio voi vaihtoehtoisesti tuottaa? (3p.)

  1. Olet suunnittelemassa PCR-alukkeita, joiden avulla pystyt monistamaan tietyn geenin koodaavan jakson (963 bp) ja luomaan PCR-tuotteen päihin restriktioentsyymien tunnistuskohdat, jotta voisit kloonata geenin ekspressiovektoriin. Olet jo suunnitellut 5'-pään (Forvvard-) alukkeen, jonka laskennallinen Tm = 62°C. Suunnittele oheisen geenin 3'-pään sekvenssin perusteella sopiva Reverse-aluke. Suunnittele aluke siten, että PCR-tuotteeseen muodostuu öamHI-tunnistuskohta (GGATCC) välittömästi translaation lopetuskodonista (TAA) alavirtaan. Ilmoita alukkeen sekvenssi 5'-3'-suunnassa.
 5´CCCACGCGCCCATTTACCGCATCGGCTTGCGATCACTCGJAAGGATTACGG3´     (2p.)
  1. Olet digestoinut insertin (1000 bp) ja pBluescript-vektorin (3000 bp) kloonaamista varten. Puhdistuksen jälkeen määrität sekä vektorin että insertin DNA-pitoisuudeksi 50 ng/ul. Käytössäsi olevan ligaasin pitoisuus on 2 U/ul. Kuinka paljon eri reaktiokomponentteja ja reagensseja pipetoit ligaatioreaktioon, kun
    • Ligaatioreaktiossa käytetään 150 ng vektoria
    • lnsertin:vektorin moolisuhde on 2
    • Ligaasia käytetään 1 U
    • Reaktion kokonaistilavuus on 20 mikrolitraa (2p.)
  2. Selitä lyhyesti:
    • Miten alkaalista fosfataasia hyödynnetään DIG-leimatun koettimen kemiluminisenssi-detektiossa? (2p.)
    • Miten vähennetään koettimesta peräisin olevaa, hybridisaatiossa syntyvää epäspesifistä taustaa? (2p.)
    • Laita seuraavat ekspressiovektorin elementit oikeaan järjestykseen: His-tag (6Xhis) / Translaation lopetuskodonit / T5 promoottori / Polylinkkeri (MCS) / Ribosomin sitoutumiskohta (RBS) / Lac-operaattori(t) / Translaation aloituskodoni / Transkription lopetussignaali (to) (2p.).
    • Joudut tekemään PCR-reaktion alukeparilla, joilla on poikkeuksellisen korkea Tm (77°C). Suunnittele alukeparille sopiva PCR-ohjelma (2p.).

25.9.2003

Vastaa lyhyesti kaikkiin kysymyksiin:

  1. Haluat ekspressoida tietyn geenin cDNA:ta E.colissa. Olet kloonannut cDNA:n (2000 bp) pUC19-vektoriin H/ncflll-fragmenttina, tehnyt siitä restriktiokartan ja sekvensoinut sen. Insertin restriktiokartoituksen perusteella siitä löytyvät seuraavat restriktioentsyymien katkaisukohdat: (Tässä kohdassa oikeassa elämässä restriktiokohdan yksinkertainen kartta. Sellainen ei kuitenkaan tämän tentin postausvaiheessa taipunut Wikiin. Nyt tilanne on toinen, mutta tentti jossain kaukana…) Seuraavaksi kloonaat cDNA:n H/ndlll-fragmenttina ekspressiovektoriin (3600bp), jonka polylinkkerialueella on insertin kloonaamista varten restriktioentsyymien katkaisukohdat seuraavassa jarjestyksessa: 5'-BamH\-Hind\\\-Sac\-Kpn\-Sma\-Sal\-EcoR\-3'.

Suunnittele tarkistusdigestio, jonka avulla selvität insertin orientaation ekspressiovektorissa. llmoita digestiossa syntyvien fragmenttien koot, mikäli

  • insertti on ekspressiovektorissa oikeassa orientaatiossa
  • insertti on vektorissa väärässä orientaatiossa (yhteensa 3p)
  1. Haluat kloonata kasvissa toimivaan ekspressiovektoriin lituruohon (Arabidopsis thaliana) transkriptiofaktorin alayksikön geenin. Päätät eristää geenin genomisesta DNA:sta PCR:n avulla ja samalla luoda PCR-tuotteeseen kloonaamiseen tarvittavat restriktioentsyymien katkaisukohdat. Tutkittuasi oheista geenin sekvenssiä huomaat iloksesi, etta muuttamalla kaksi aloituskodonin viereistä nukleotidia saat luotua Forward-alukkeen 5'-päähän Ncol-kohdan (CCATGG), jonka avulla pystyt kloonaamaan geenin oikeassa lukukehyksessä ekspressiovektoriin. Reverse-alukkeeseen päätät lisätä Bc/l-sekvenssin (TGATCA).
  • Esitä sekä Forward- että Reverse-alukkeen sekvenssit 5'-3'-suunnassa
  • Koska joudut suunnittelemaan alukkeet tiettyyn kohtaan sekvenssia, ne eivät välttämättä täytä kaikkia optimaalisen alukeparin vaatimuksia. Selitä lyhyesti, mita teoreettisia ongelmia suunnittelemiisi alukkeisiin liittyy. (yhteensa 4p)
  1. Faagikirjaston tiitteri on 2.5×10^8 pfu/ml. Minkälaisen laimennoksen tekisit, jotta maljatessasi sitä 100 \i\ saisit noin 500 plakkia maljalle? Selitä laimennoksen tekeminen käytännössä. (2p)
  2. Selitä lyhyesti: (yhteensa 7p)
  • Prehybridisaatio
  • Faagikirjaston sekundaariseulonta
  • Anti-DIG-AP ja sen käyttö kemiluminisenssidetektiossa
  • Dideoksinukleotiditja niiden käyttö sekvensoinnissa
  • Restriktioentsyymidigestiossa DNA:han syntyva “tahmea pää” (“sticky end”)
  • IPTG:n käyttö geeniekspression säätelyssa E.colissa
  • Olet digestoinut plasmidin yhdellä restriktioentsyymillä kloonausta varten. Tarkistusgeelissä näet odottamasi linearisoidun plasmidin kokoisen raidan lisäksi sitä alemman ja ylemmän raidan. Miten selität tämän?

30.3.2001

Vastaa kaikkiin kysymyksiin konseptipaperille. Vastaa lyhyesti ja ytimekkaasti!

  1. Olet eristänyt koivun (Betula pendula) cDNA-kirjastosta kylmänkestävyyteen liittyvän geenin käyttäen koettimena lituruohosta (Arabidopsis thaliana) peräisin olevaa EST:ia (Expressed Sequence Tag). Olet onnistunut, yrityksen ja erehdyksen kautta, subkloonaamaan kyseisen cDNA:n (koko 2200 bp) molemmissa orientaatioissa Bluescript-vektoriin. Bluescript (koko 3000 bp) sisältää MCS-kohdan seka sitoutumiskohdat universaalialukkeille. Digestoit molemmissa orientaatioissa olevan plasmidin EcoRl-, HindlH-., Smal- sekä Xhol -restriktioentsyymeilla. Saat seuraavan kokoiset fragmentit:
 Orientaatio I                         Orientaatio II \\ 
 EcoRl	 0,6 kb; 1,3 kb; 3,3 kb	 Orientaatio II  0,3 kb; 1,3 kb; 3,6 kb\\ 
 HindLII	 1,3 kb; 3,9 kb	         Orientaatio II  0,9 kb; 4,3 kb\\ 
 Smal	         0,3 kb; 1,2 kb; 3,7 kb	 Orientaatio II    0,7 kb; 1,2 kb; 3,3 kb\\ 
 Xhol	         1,0kb; 4,2kb            Orientaatio II     1,2kb; 4,0kb\\ 

Laadi insertista restriktiokartta. Laadi myos suunnitelma, miten sekvensoisit restriktiokarttaasi hyvaksi kayttaen molemmat juosteet koko insertista. (6p)

  1. Mitä reagensseja pipetoit lineaariseen PCR-reaktioon, jolla aiot valmistaa yksijuosteisen, DIG-leimatun koettimen? (2p)
  2. Olet digestoinut vektoriplasmidin yhdellä restriktioentsyymilla kloonausta varten. Entsyymilla on vain yksi tunnistuskohta vektorissa. Tarkastusgeelissä näet odottamasi yhden raidan sijasta kolme: linearisoiden plasmidin kokoinen raita, sekä sitä alempi ja ylempi raita. Miten voit selittaa taman? (2p)
  3. Selitä lyhyesti seuraavat termit (3p):
    • cDNA
    • kirjaston tiitteri
    • blokkaus
  4. Olet eristänyt patogeenisen bakteerin Salmonella typhimuriumin adhesiinigeenin ja sekvensoinut sen. Adhesiinin avulla ko. bakteeri kykenee sitoutumaan suolen limakalvoon ja aiheuttamaan infektion. Millä tavoin tutkisit, mikä osa adhesiiniproteiinista sitoutuu limakalvon kollageeniin?