Warning: Declaration of action_plugin_captcha::register(&$controller) should be compatible with DokuWiki_Action_Plugin::register(Doku_Event_Handler $controller) in /var/www/fs3/43/helixryf/public_html/tenttiwiki/lib/plugins/captcha/action.php on line 0
geenitekniikan_luennot - Tenttiwiki
Tenttiwiki

Geenitekniikka

7.2.2012

Tervetuloa geenitekniikan tenttiin!

Tentti koostuu kolmesta pakollisesta kysymyksestä. Ensimmäisen kysymyksen tarkoituksena on käsitteiden tunnistaminen ja määrittely. Toisessa kysymyksessä on tarkoitus jo hieman syventää tarkastella annettuja käsitteitä. Kolmas kysymys on soveltava ja vaativin. Muista kuitenkin määritellä käsitteet jokaisessa tehtävässä. Tentissä vastausten tulisi olla myös selkeitä jäsenneltyjä. Tämä toimii myös yhtenä arviointiperusteena (1p/tehtävä hyvin kirjoitetusta ja jäsennellystä tekstistä).

Onnea tenttiin!

    • Geenitekniikassa rakennetaan rekombinantti-DNA molekyylejä liittämällä tutkittavia DNA-fragmentteja erityyppisiin kantajamolekyyleihin. Kuvaa kolme erilaista kantajamolekyyliä ja anna esimerkki tilanteista, jolloin käyttäisit näitä rekombinatti-DNA:n balmistamiseen. (4p)
    • Koettimia käytetään geenitekniikassa lukuisiin eri tarkoituksiin. Kerro, mitä käsitteellä koetin tarkoitetaan ja mihin sen toiminta perustuu, miten koetin valmistetaan ja anna kaksi esimerkkiä tilanteista, joissa koettimia käytetään. (5p)
  1. Yksittäisiä geenejä eristetään usein geenikirjastoista ja tähän tarkoitukseen voidaan rakentaa kahdentyyppisiä kirjastoja; i) genomisia kirjastoja ja ii) cDNA kirjastoja.
    • Vertaile näiden kirjastojen sisältämää informaatiota. (7p)
    • Pohdi, miksi genomisen kirjaston valmistuksesssa kohde-DNA:lle suoritetaan osittainen katkaisu käyttämällä jotain nelipilkkojaa (restriktioentsyymiä, joka tunnistaa neljä emästä) sen sijaan, että DNA:lle tehtäisiin normaali täydellinen pilkkominen. (2p)
  2. Työskentelet kliinisessä laboratoriossa ja tehtävänäsi on PCR-tekniikkaa hyödyntäen määrittää tietylle geneettiselle taudille altistavan mutaation läsnäolo tutkittavina olevissa verinäytteissä. Mutaatio on geenissä gt15 ja kyseessä on yhden nukleotidin muutos geenin sekvenssissä, siten että normaalialleelissa on tietyssä kohdassa C ja mutanttialleelissa on tällä kohtaa A.

Alla on esitetty osa geenin sekvenssistä (500 nukleotidin mittaisen osan sekvenssiä ei ole annettu) ja merkittynä on nukleotidi, joka siis terveillä yksilöillä on C ja mahdollisilla potilailla A. Määrittele lyhyesti PCR tekniikan keskeiset periaatteet. Kuvaa ja motivoi työvaiheet, joilla PCR tekniikkaa hyödyntäen määrität, kumpi alleeleista verinäytteen antaneilla yksilöillä on. Suunnittele myös alukkeet, joita määrityksessäsi tulet käyttämään. (9p)

 gt15 sekvenssi (osa)
 
 CCGATGAGTGATGTGTAAACCGTCGGATAGTCGTGT__**C**__ACGTGTGTCACACGCAGCTGCGCGCGCGCATCGACGCGCGG---500nukleotidia---CGAGCTGGACCGGCTTGAGCGTGAGCCCGGAGCTTGTGCGCGCAGTCGAC

16.11.2010

Vastaa lyhyesti 3 kysymykseen

  1. Kuvaa lyhyesti alpha-komplementaation periaate ja kuinka sitä hyödynnetään rekomninanttien seulonnassa (lacZ geenin hyödyntäminen rekombinanttien identifioinnissa)
  2. Miten plasmidien ja kromosomien konformaatioeroa (plasmidit ovat superkierteisiä) voidaan käyttää hyväksi plasmidi-DNA:n eristyksessä?
  3. Mitä ominaisuuksia hyvässä tuottovektorissa (ekspressiovektori) tulee olla?
  4. Biokemistiystäväsi, innokas kalankasvattaja, on eräästä arktisesta kalalajista eristänyt pienen määrän proteiinia, joka veteen sekoitettuna alentaa sen jäätymispistettä. Vaistosi sanoo, että talvet lähitulevaisuudessa tulevat olemaan ennätyskylmiä, ja Itämeri tulee jäätymään jo syyskuun aikana. Mielessäsi alkaa hahmottua rahanarvoinen idea. Jos pystyisit bakteereissa tuottamaan suuria määriä kyseistä proteiinia, niin voisit lilpailla jäänmurtajien kanssa levittämällä (maksua vastaan) proteiinia laivaväylille. Ainoa ongelma on, että tuottaaksesi proteiinia sinulla pitää olla sitä vastaava DNA-sekvenssi. Päätät aloittaa projektin ja tätä varten tilaat Alaskan “artificial arctic fish”-yhtiöstä kyseisen kalan mRNA:sta valmistetun cDNA-ekspressiokirjaston. Ystävältäsi saat, tietenkin tulevia optioita vastaan, pienen määrän proteiinia, jonka avulla välittömästi tuotat vasta-ainetta proteiinille. Kuvaa strategiasi, jolla aiot tästä kirjastosta eristää kyseistä proteiinia koodaavan cDNA-kloonin.

12.10.2010

Vastaa LYHYESTI kolmeen kysymykseen

  1. Kuvaa lyhyesti alfa-komplementaation periaate ja kuinka sitä hyödynnetään rekombinattien seulonnassa.
  2. Kuvaa lyhyesti polymeraasiketjureaktion (PCR:n) periaate.
  3. Kerro miten cDNA kirjasto eroaa genomisesta kirjastosta. (Kirjastojen valmistus ja kloonien informaatiosisältö)
  4. Olet käyttänyt hiivan 1-hybridi systeemiä ja eristänyt cDNA kloonin, joka koodaa tutkimaasi geeniä säätelevää proteiinia. Kun esittelet tulokset pomollesi hän pyytää sinua kertomaan, miten identifioit DNA sekvenssin, jonka analyysiä varten liitit selektoitavaan geenin eteen hiivassa. Kerro, mitä vastasit pomollesi, eli miten identifioit DNA-sekvenssin, johon tutkimaasi geeniä säätelevä proteiini sitoutuu.

9.10.2009

Vastaa LYHYESTI kolmeen seuraavista kysymyksistä

  1. Kuvaa lyhyesti α-komplementaation periaate ja kuinka sitä voidaan hyödyntää rekombinanttien seulonnassa.
  2. Kuvaa lyhyesti cDNA-kirjaston valmistus
  3. Kuvaa lyhyesti hiivan 2-hybridi systeemin käyttö proteiinien välisten interaktioiden tutkimisessa
  4. Olet eristänyt hamsterista n. 100 kDa proteiinin. Koska tutkimustuloksesi viittaavat siihen, että kyseessä on jonkinlainen kasvutekijä (GF), haluat jatkotutkimuksia varten kloonata proteiinia vastaavan geenin. Pilkot proteiinia proteolyyttisesti fragmenteiksi, joista määrität N-terminaaliset aminohapposekvenssit. Oheisesta kuvasta selviävät saamasi sekvenssit ja niiden oletettu sijainti proteiinissa GF. Haluat valmistaa kahden aminohapposekvenssin pohjalta DNA-alukkeet monistaaksesi niitä vastavan osan GF-geeniä hamsterin cDNA-kirjastosta. Pyrit kummassakin alukkeessa (tai alukeseoksessa) pitämään muuntelun mahdollisimman pienenä. Suunnittele valitsemiesi aminohapposekvenssien perusteella monistukseen soveltuvat 17 nt mittaiset oligonukleotidit niin, että voit niillä monistaa alukkeiden väliin jäävän geenialueen. Muuntelua kumpaankin alukkeeseen saa tulla mahdollisimman vähän. Kirjoita sekvenssit siten, että niiden suunta (5'-3') ja sekvenssissä esiintyvä muuntelu selviävät yksiselitteisesti.
 GF-proteiini
 N-=1=-------===2===----==3==----------====4====----------=====5=====--C
  1. MAAPLVPLS
  2. KGFLDKQGFYVA
  3. LDVLGRVWDLS
  4. DRLDEMDQQKAKL
  5. DPFAPSSSAK

10.10.2008

Vastaa LYHYESTI kolmeen seuraavista kysymyksistä

  1. Kuvaa lyhyesti α-komplementaation (lacZ geenin hyödyntäminen insertionaalisessa inaktivaatiossa) periaate
  2. Kuvaa lyhyesti cDNA kirjaston valmistus
  3. Kuvaa lyhyesti kosmidien rakenne ja niiden käyttö kloonauksessa
  4. Kuvaa lyhyesti hiivan 2-hybridisysteemin käyttö proteiinien välisten interaktioiden tutkimisessa

12.10.2007

Vastaa LYHYESTI kahteen seuraavista kysymyksistä.

  1. Kuvaa lyhyesti α-komplementaation periaate.
  2. Mitä tärkeitä komponentteja hyvässä ekspressiovektorissa tulee olla?
  3. Kuvaa kaksi menetelmää, joilla voit määrittää transkriptiofaktorien sitoutumiskohdat geenin promoottorialueella.

3.11.2006

Vastaa LYHYESTI kolmeen seuraavista kysymyksistä.

  1. Kuvaa lyhyesti α-komplementaation periaate.
  2. Kuvaa kaksi menetelmää, joilla voit määrittää transkriptiofaktorien sitoutumiskohdat geenin promoottorialueella.
  3. Kuvaa lyhyesti cDNA-kirjaston valmistus.
  4. Kuvaa lyhyesti kosmidien rakene ja niiden käyttö kloonauksessa.

20.10.2006

Vastaa LYHYESTI kolmeen seuraavista kysymyksistä.

  1. Kuvaa lyhyesti α-komplementaation periaate.
  2. Kerro, miten voit käyttää vasta-aineita hyväksesi cDNA ekspressiokirjaston seulonnassa.
  3. Kuvaa lyhyesti cDNA-kirjaston valmistus.
  4. Olet eristänyt hamsterista n. 100 kDa proteiinin. Koska tutkimustuloksesi viittaavat siihen, että kyseessä on jonkinlainen kasvutekijä (GF), haluat jatkotutkimuksia varten kloonata proteiinia vastaavan geenin. Pilkot proteiinia proteolyyttisesti fragmenteiksi, joista määrität N-terminaaliset aminohapposekvenssit. Oheisesta kuvasta selviävät saamasi sekvenssit ja niiden oletettu sijainti proteiinissa GF. Haluat valmistaa kahden aminohapposekvenssin pohjalta DNA-alukkeet monistaaksesi niitä vastavan osan GF-geeniä hamsterin cDNA-kirjastosta. Pyrit kummassakin alukkeessa (tai alukeseoksessa) pitämään muuntelun mahdollisimman pienenä. Suunnittele valitsemiesi aminohapposekvenssien perusteella monistukseen soveltuvat 17 nt mittaiset oligonukleotidit niin, että voit niillä monistaa alukkeiden väliin jäävän geenialueen. Muuntelua kumpaankin alukkeeseen saa tulla mahdollisimman vähän. Kirjoita sekvenssit siten, että niiden suunta (5'-3') ja sekvenssissä esiintyvä muuntelu selviävät yksiselitteisesti.
 GF-proteiini
 N-=1=-------===2===----==3==----------====4====----------=====5=====--C
  1. MAAPLVPLS
  2. KGFLDKQGFYVA
  3. LDVLGRVWDLS
  4. DRLDEMDQQKAKL
  5. DPFAPSSSAK
 

6.10.2006

Vastaa LYHYESTI kolmeen seuraavista kysymyksistä.

  1. Kuvaa lyhyesti α-komplementaation (lacZ geenin käyttö insertionaalisessa inaktivaatiossa) periaate.
  2. Kuvaa lyhyesti kosmidien rakenne ja niiden käyttö kloonauksessa.
  3. Kerro lyhyesti Sangerin dideoksinukleotidien käyttöön perustuva DNA:n sekvensointimenetelmä
  4. Työskentelet tutkimuslaboratoriossa, jossa tutkitaan geenien hormonaalista säätelyä. Ensimmäinen tehtäväsi on määrittää transkriptiofaktorien sitoutumiskohdat horm1 geenin promoottorialueella. Aloitat työt ripeästi ja eristät hormoni-indusoiduista soluista valmistetusta cDNA kirjastosta horm1 geeniä vastaavan kloonin, jota käytät myöhemmissä analyyseissä. Päätät käyttää EMSA ja DNA footprinting tekniikoita cDNA-molekyylisi analyysiin. Kolmen kuukauden kuluttua saat vihdoin tulosta aikaiseksi, mutta kun esität tuloksesi esimiehellesi, hän ilman sen enempiä puheita antaa sinulle potkut. Miksi? Kerro myös miten sinun olisi pitänyt edetä saadaksesi haluamasi tuloksen?

7.10.2005

Vastaa LYHYESTI kolmeen seuraavista kysymyksistä

  1. Kuvaa lyhyesti alfa-komplementaation (lacZ geenin hyödyntäminen insertionaalisessa inaktivaatiossa) periaate.
  2. Kuvaa lyhyesti cDNA kirjaston valmistus.
  3. Kuvaa lyhyesti kosmidien rakenne ja niiden käyttö kloonauksessa.
  4. Kerro, miten voit käyttää vasta-aineita hyväksesi cDNA ekspressiokirjaston seulonnassa.

13.10.2004

Vastaa kolmeen kysymykseen.

  1. Kuvaa lyhyesti alfa-komplementaation periaate.
  2. Kuvaa lyhyesti Sangerin dideoksinukleotidien käyttöön perustuva DNA:n sekvensointimenetelmä.
  3. Mitä tärkeitä komponentteja hyvässä ekspressiovektorissa tulee olla?
  4. Kuvaa lyhyesti cDNA kirjaston valmistus.

18.10.2002

Vastaa LYHYESTI kolmeen seuraavista kysymyksistä.

  1. Kuvaa lyhyesti alfa-komplementaation (lacZ geenin kaytto insertionaalisessa inaktivaatiossa) periaate.
  2. Olet käyttänyt “differential screening” metodia ja eristänyt kaniinin cDNA kirjastosta kloonin, jonka nyt haluat sekvensoida. Olet subkloonannut insertin 2.3 kb EcoRI-fragmenttina pBluescript-plasmidiin sekvensointia varten. Kuvaa vahintaan kaksi strategiaa, joita voit käyttää saadaksesi koko cDNA-fragmentin sekvensoitua. Käytössäsi on kaikki tunnetut entsyymit ja voit halutessasi tilata synteettisiä oligonukleotideja. Huom 1. ei yksityiskohtia itse työstä, kuvaa vain periaatteet. Huom 2. Tässä ei kysytä sekvensointitekniikoita.
  3. Työskentelet tutkimuslaboratoriossa, jossa tutkitaan geenien hormonaalista saatelya. Ensimmäinen tehtäväsi on määrittää transkriptiofaktorien sitoutumiskohdat horm1 geenin promoottorialueella. Aloitat työt ripeästi ja eristät hormoni-indusoiduista soluista valrnistetusta cDNA kirjastosta horm1 geeniä vastaavan kloonin, jota käytät myöhemmissä analyyseissä. Päätät käyttää EMSA ja DNA footprinting tekniikoita cDNA-molekyylisi analyysiin. Kolmen kuukauden kuluttua saat vihdoin tulosta aikaiseksi, mutta kun esitat tuloksesi esimiehellesi, hän ilman sen enempia puheita antaa sinulle potkut. Miksi? Kerro myos miten sinun olisi pitänyt edetä saadaksesi haluamasi tuloksen?
  4. Kuvaa lyhyesti cDNA kirjaston valmistus.

19.10.2001

Vastaa kolmeen seuraavista kysymyksistä.

  1. Kuvaa lyhyesti alfa-komplementaation periaate.
  2. Kerro miten voit käyttää vasta-aineita cDNA kirjaston seulonnassa.
  3. Kuvaa lyhyesti cDNA kirjaston valmistus.
  4. Kuvaa kaksi menetelmää, joilla voit määrittää transkriptiofaktorien sitoutumiskohdat geenin promoottorialueella.

27.10.2000

Vastaa kolmeen seuraavista kysymyksista.

  1. Kuvaa lyhyesti a-komplementaation periaate.
  2. Työskentelet tutkimuslaboratonossa, jossa tutkitaan geenien hormonaalista saatelya. Ensimmainen tehtäväsi on määrittää transkriptiofaktorien sitoutumiskohdat horm1 geenin promoottorialueella. Aloitat työtnopeasti ja eristät hormoni-indusoiduista soluista valmistetusta cDNA kirjastosta horm1 geenia vastaavan kloonin, jota käytät myöhemmissä analyyseissa. Päätät käyttää EMSAja DNA footprinting tekniikoita cDNA-molekyylisi analyysiin. Kolmen kuukauden kuluttua saat vihdoin tulosta aikaiseksi, mutta kun esität tuloksesi esimiehellesi, hän ilman sen enempia puheita antaa sinulle potkut. Miksi? Kerro myös miten sinun olisi pitänyt edetä saadaksesi haluamasi tuloksen?
  3. Olet käyttänyt “differential screening” metodia ja eristänyt kaniinin cDNA kirjastosta kloonin, jonka nyt haluat sekvensoida. Olet subkloonannut insertin 2.3 kb EcoRI-fragmenttina pBluescript-plasmidiin sekvensointia varten. Kuvaa vähintään kaksi strategiaa, joita voit käyttää saadaksesi koko cDNA-fragmentin sekvensoitua. Kaytössäsi on kaikki tunnetut entsyymit ja voit halutessasi tilata synteettisiä oligonukleotideja. Huom 1. ei yksityiskohtia itse työstä, kuvaa vain periaatteet. Huom 2. Tässä ei kysytä sekvensointitekniikoita.
  4. Kerro, miten voit käyttää vasta-aineita hyväksesi cDNA kirjaston seulonnassa.

20.10.2000

Vastaa kolmeen seuraavista kysymyksista.

  1. Kuvaa lyhyesti alfa-komplementaation periaate.
  2. Kuvaa lyhyesti kosmidien rakenne ja niiden käyttö kloonauksessa.
  3. Kuvaa kaksi menetelmää, joilla voit määrittää transkriptiofaktorien sitoutumiskohdat geenin promoottorialueella.
  4. Kuvaa lyhyesti polymeraasiketjureaktion (PCR) periaate.