Warning: Declaration of action_plugin_captcha::register(&$controller) should be compatible with DokuWiki_Action_Plugin::register(Doku_Event_Handler $controller) in /var/www/fs3/43/helixryf/public_html/tenttiwiki/lib/plugins/captcha/action.php on line 0

Warning: Cannot modify header information - headers already sent by (output started at /var/www/fs3/43/helixryf/public_html/tenttiwiki/lib/plugins/captcha/action.php:0) in /var/www/fs3/43/helixryf/public_html/tenttiwiki/inc/auth.php on line 549

Warning: Cannot modify header information - headers already sent by (output started at /var/www/fs3/43/helixryf/public_html/tenttiwiki/lib/plugins/captcha/action.php:0) in /var/www/fs3/43/helixryf/public_html/tenttiwiki/inc/actions.php on line 207
evoluutiobiologian_perusteet - Tenttiwiki
Tenttiwiki

Evoluutiobiologian perusteet

Kotitentti 2017

Helanterä

  1. Loispistiäislajin X naaraat munivat isäntäeläimen toukkiin. Allaoleva taulukko kertoo kunkin isäntätoukan luona havaittujen aikuisten naaraiden lukumäärän, sekä kuhunkin isäntään munituista munista kuoriutuneiden jälkeläisten sukupuolet ja massat.
    • A) Sopivatko havaitut sukupuolijakaumat Local mate competition –teorian ennusteisiin, ja mitä dataa hankkisit johtopäätöksesi tueksi? Perustele.
    • B) Miten tutkisit sitä miksi sukupuolijakaumat vaihtelevat niin paljon sellaistenkin laikkujen välillä joissa havaittuja naaraita on sama määrä? Perustele.
 
Havaittu  Koiras-      Naaras-      Koiraan        Naaraan
naaraiden jälkeläisten jälkeläisten keskimäär.     keskimäär.
määrä     lkm          lkm          massa (mg)     massa (mg)
1	   3	        11	    3.14	   10.36	
2	   5	        10	    3.24	   10.69	
3  	   25	        21	    3.34	   10.16	
2	   7	        13	    3.34	   10.26	
1          3	        5	    3.82	   10.79	
1	   10	        12	    3.15	   10.60	
1	   4	        13	    3.52	   10.13	
3	   20	        17	    3.07	   10.14	
4	   18	        26	    3.98	   10.42	
3	   12	        25	    3.48	   10.28	
2	   9	        23	    3.26	   10.62	
1	   2	        14	    3.53	   10.09	
1	   1	        10	    3.75	   10.24	
1	   11	        9	    3.72	   10.39	
1	   1	        15	    3.39	   10.12	
1	   2	        12	    3.19	   10.01	
2	   7	        19	    3.31	   10.30	
2	   10	        17	    3.60	   10.95	
3	   30	        25	    3.08	   10.22	
4	   50	        33	    3.94	   10.54	
2	   10	        10	    3.12	   10.40	
3	   13	        19	    3.28	   10.51	
4	   45	        37	    3.54	   10.70	
4	   20	        28	    3.00	   10.18	

Pietiäinen

  1. Pohdi artikkelin Asghar et al. 2015 “Hidden costs of infection: Chronic malaria accelerates telomere degradation and senescence in wild birds” tuloksia suhteessa vanhenemista selittäviin hypoteeseihin käyttäen hyväksesi luentomuistiinpanoja ja Herron & Freeman kirjaa.

Seppä

  1. Evoluutiobiologian perusteiden kurssin vm. 2017 opiskelijat päättivät lähteä yhdessä rankan kurssin jälkeen hyvin ansaitulle telttaretkelle Lapin erämaihin. Kurssilaiset - 10 miestä ja 14 naista - eksyivät kuitenkin pahan kerran ja katosivat iäksi. Matkalaiset odottivat turhaan pelastusta ja lopulta totesivat olevansa uuden populaation perustajia. Koska kurssilaiset olivat juuri käyneet populaatiogenetiikan luennoilla, he alkoivat arvioida uudessa populaatiossaan tapahtuvia geneettisiä ilmiöitä. Tarkasteltavana on kaksi geneettistä ominaisuutta: leuan muoto ja hymykuopat. Loven leuassa aiheuttaa yhden lokuksen alleelipari, jossa normaalin leuan tuottava alleeli on dominoiva ja lovileukaisen fenotyypin tuottava alleeli on resessiivinen. Myös hymykuoppien esiintymistä määrää yhden lokuksen geenipari, jossa sileäposkisuus on dominoiva fenotyyppi ja hymykuopat tuottaa resessiivinen alleeli.
  • A) Biologipopulaatiossa ei alun perin ole lovileuka-alleelia lainkaan, mutta sitä syntyy joka tuhannelle uuden mutaation seurauksena. Lovileukaisia ei pidetä haluttuina kumppaneina ja se pienentää näiden yksilöiden pariutumismenestystä 10 prosentilla. Laske ensin mihin lovileuka- alleelin frekvenssi asettuu ajan myötä biologipopulaatiossa mutaation ja valinnan tasapainossa jos oletetaan populaatiokooksi ääretön? Käytä sitten simulaatio-ohjelmaa AlleleA1 ja arvioi kuinka nopeasti populaatio saavuttaa tasapainofrekvenssin (1.25 p.)
  • B) Todellisuudessa populaatio on perustamishetkellä pieni. Laske alkuperäisen populaation epätasaiseen sukupuolijakaumaan perustuva efektiivinen populaatiokoko. Biologipopulaatio alkaa lisääntyä ja lisääntyminen on tiukan monogaamista. Neljään perheeseen syntyy 1 lapsi, kolmeen 2 lasta, kahteen 3 lasta ja yhteen 4 lasta. Laske epätasaiseen lisääntymismenestykseen perustuva efektiivinen populaatiokoko ja arvioi vähentääkö epätasainen sukupuolijakauma vai epätasainen lisääntymismenestys enemmän efektiivistä populaatiokokoa? (1.25 p.).
  • C) Miten ajattelet laskemasi efektiivisen populaatiokoon vaikuttavan populaation evolutiiviseen potentiaaliin jos sitä verrattaan populaation todelliseen kokoon? Mitä lovileukaisuusmutantille odotetaan tapahtuvan tässä tilanteessa? Käytä simulaatio-ohjelmaa AlleleA1 (1 p.)
  • D) Alueen eristyneisyydestä huolimatta biologipopulaation ja Kuolan niemimaalla asustavien kolttasaamelaisten kanssa välillä alkaa esiintyä geenivirtaa niin että joka sukupolvessa biologit ja kolttasaamelaiset vaihtavat yhden migrantin (m= ~0.05). Kaikilla biologeilla on hymykuopat, kun taas koltilla on aina sileät posket. Siloposkia kuitenkin karsastetaan puolisoina biologipopulaatiossa ja heidän kelpoisuutensa jää 25% hymykuopallisten kelpoisuutta pienemmäksi. Arvioi mihin sileäposkisuusalleelin frekvenssi asettuu tässä valinnan ja migraation tasapainossa. Oletetaan laskutoimitusta varten että geneettinen ajautuminen ei vaikuta alleelien tasapainofrekvensseihin. Käytä sitten AlleleA1- ohjelmaa arvioidaksesi mitä todellisessa tilanteessa tapahtuisi (1.5 p.)

Kotitentti 1

2008

Tentti aukesi keskiviikkona klo 13.00 ja sulkeutui lauantaina klo 9.00.

  1. Lotta: Paperiampiaisella on havaittu populaatioiden välisiä eroja sosiaalisuudessa siten että joissakin populaatioissa kaikki yksilöt perustavat pesän yksin ja toisissa populaatioissa yksilöt perustavat pesiä 3-5 yksilön ryhmissä. Haluat selvittää ovatko nämä erot perinnöllisiä vai johtuvatko ne yksilöiden ilmiasun joustavuudesta ja siihen liittyvistä eri ympäristöjä myötäävistä reaktionormeista. (Vastaa lyhyesti ja ytimekkäästi ja muista että mitä yksinkertaisempi ja helppotöisempi suunnitelma sen varmemmin saat tuloksia joihin voit luottaa; toisaalta liian yksinkertainen suunnitelma jättää ehkä liian monta vaihtoehtoista selitysmallia tuloksille.)
    • mitkä ovat hypoteesisi ja niistä johdetut ennusteet?
    • mitä lähestymistapaa/tapoja käyttäisit? Miksi juuri nämä?
    • mitä tietoja tarvitsisit toisaalta yksilöiden ominaisuuksista, toisaalta niiden ympäristöstä?
    • mitä oletuksia joudut tekemään?
    • miten selvittäisit onko ampiaisten käyttäytyminen adaptiivista?
    • mitä muuta sinun tulisi ottaa huomioon tässä tutkimuksessa?
  2. Näistä kullekin tenttiin osallistujalle oli näkyvillä jompikumpi:
    • Juha: Mitkä tekijät vaikuttavat West Nile -viruksen leviämiseen? Kyseisen viruksen leviämiseen vaikuttavista tekijöistä suurin osa löytyi artikkelista. Muita, yleisiä taudinaihettajien leviämiseen vaikuttavia tekijöitä käytiin läpi luennolla, ja kirjan kappaleissa.
    • Hannu: (Kysymyksen liitteenä oli artikkeli, joka piti lukea.) Mikä oli [luetun] artikkelin keskeisin johtopäätös?Pohdi kyseistä päätelmää antagonistinen pleiotropia –käsitteen näkökulmasta.
  3. Hanna: Tutkitaan Uuden Guinean sademetsistä vastikään löydetyn töyhtötiitihippiäisen parinvalintaa.

Linnun on todettu pesivän pareittain, ja molemmat vanhemmat ruokkivat poikasia. Geneettisissä analyyseissa on kuitenkin todettu, että naaraat parittelevat toisinaan muidenkin kuin pesällä poikasia ruokkivan koiraan kanssa. Yrität selvittää, miksi koiraat eivät lakkaa hoitamasta poikasia, vaikka ne selvästikään eivät ole yhtä usein sukua poikasille kuin naaraat. Koetat soveltaa Hamiltonin sääntöä tähän tilanteeseen: kun b on poikasille hoidosta koituva hyöty, r on sukulaisuuskerroin ja c on hoitavalle yksilölle koituva kustannus, niin vanhemman kelpoisuuden voi ajatella olevan

          br – c

Tässä yhteydessä b kuvaa poikasen selviytymisen paranemista ja c:hen liittyy vanhemman kunnon huononeminen ja seuraavasta talvesta huonommin selviäminen. Kokeellisesti olet todennut, että keskimäärin b = 0.2 ja c = 0.4.

  • Kerro, millaisia menetelmiä käyttäen olet mitannut nämä arvot.
  • Kannattaako koiraan hoitaa poikasia, jos viidestä munasta keskimäärin 1, 2, 3, 4, tai 5 on omia (siis tutki 5 eri tapausta)? Esitä myös, miten br – c mahtaisi muuttua, jos tarkastelemme vain erityisen kirkasvärisiä koiraita. Millaisia muutoksia voisi olla arvoissa b, r ja c? Esitä numeroesimerkki tukemaan väitettäsi näiden koiraiden ennustetusta käyttäytymisestä (jokin vaihtoehdoista: nämä koiraat hoitavat vähemmän / täsmälleen yhtä paljon / enemmän kuin ”tavalliset” koiraat).
    • Mittaamasi arvot ovat (tilastollisen vaihtelun rajoissa) samat kummallekin sukupuolelle. Mitä mieltä olet ystävästi väitteestä, että olet väistämättä mitannut jotain väärin: koiraan c:n pitäisi poiketa naaraan arvosta, koska se investoi muniin ja niiden selviytymiseen vähemmän resursseja kuin naaras? Entä toisen ystäväsi väitteestä, että koiraan r on tulevissa pesyeissäkin pienempi kuin naaraan, ja tämä pitäisi ottaa huomioon c:tä laskettaessa?
    • Millaiset seksuaalivalinnan hypoteesit saattaisivat selittää naaraiden parittelukäyttäytymistä tällaisessa tilanteessa? Lyhyt lista mahdollisista eduista riittää.

Kotitentti 2

2008

  1. Merinorsuja on kaksi lajia, pohjanmerinorsu (Mirounga angustirostris) ja etelänmerinorsu (M. leonina), jotka elävät Tyynellä merellä ja Antarktiksen tienoilla. Kummankin lajin dominanteilla koirailla on isoja haaremeita. Pohjanmerinorsu oli vähällä kuolla sukupuuttoon sata vuotta sitten ja populaatiokoko oli alimmillaan ehkä vain parikymmentä yksilöä. Geneettiset työt ovat osoittaneet lajin geneettisen muuntelun olevan vähäistä, allotsyymitöiden antama arvio on, että heterotsygotian määrä pohjanmerinorsun populaatiossa on vain He=0.00028. Tehtävänäsi on arvioida, miksi pohjanmerinorsun geneettinen muuntelu on niin olematonta. Perustele kaikissa tehtävän kohdissa, miten päädyit esittämiisi johtopäätöksiin. Voit käyttää apuna harjoituksissa käytettyä simulointiohjelmaa, jos se on tarpeen.
    • Etelänmerinorsun populaatioissa entsyymigeenien keksimääräinen heterotsygotia on He = 0.028. Jos pohjanmerinorsun populaatioissa on aiemmin ollut saman verran muuntelua, kuinka monta sukupolvea keskimäärin vie ennenkuin heterotsygotian määrä putoaa arvosta 0.028 arvoon 0.00028? Oleta, että pohjanmerinorsun populaatiossa oli vain 26 yksilöä, 12 urosta ja 14 naarasta. Lisääntyminen tapahtui yksinomaan kahdessa haaremissa, joissa kummassakin oli yksi uros ja 7 naarasta.
    • Mikä oli pohjanmerinorsun tehollinen (efektiivinen) populaatiokoko pullonkaulan aikana?
    • Jos yhdessä geenilokuksessa oli alun perin kaksi yhtä runsasta alleelia (kummankin frekvenssi 50%), kuinka todennäköisesti tämän lokuksen muuntelu voi kokonaan kadota näin pienessä populaatiossa kymmenessä sukupolvessa?
    • Etelänmerinorsun yhdessä immuunipuolustuksen geenissä on muuntelua siten, että viidestä tuhannesta yksilöstä kaksi on homotsygootteja haitallisen resessiivisen alleelin suhteen. Jos populaation genotyypit noudattavat Hardy-Weinberg –lukusuhteita, paljonko populaatiossa on heterotsygootteja? Kuinka voimakasta on karsiva valinta homotsygootteja vastaan, jos alleelifrekvenssi on mutaation ja valinnan tasapainossa ja mutaatiofrekvenssi on μ = 10-5?
    • Entä jos kyseisen geenin nyt vallitseva dominantti alleeli onkin uusi edullinen mutantti, joka on syrjäyttänyt vanhan alleelin? Kuinka monta sukupolvea kestää, että dominantin mutantin frekvenssi nousee alkuarvosta (käytä arvoa 0.01) arvoon 0.95? Oleta ensin että populaatio on äärettömän suuri. Toista sama olettaen, että populaation tehollinen koko on 500. Mitä silloin tapahtuu?
    • Miten voit selvittää, onko edellisten kohtien (d, e) harvinainen alleeli uusi mutaatio vai vanha alleeli, jonka uusi edullinen mutaatio on syrjäyttänyt?
  2. astaa perustellen seuraaviin kysymyksiin. a,b,c: 1 piste, d: 3 pistettä
    • Miksi nukleotidikorvautumisten estimoinnissa tarvitaan teoreettisia malleja (kuten Jukes-Cantorin malli)? Miksi on olemassa erilaisia malleja? (1 piste)
    • Mikä on geeniduplikaatioiden merkitys evoluutiossa? (1 piste)
    • Mikä on koalesenssiteorian keskeinen merkitys molekyylivoluution tutkimuksessa? (1 piste)
    • Suuntaava ja tasapainottava valinta ovat yleisimpiä luonnonvalinnan muotoja. Molemmat karsivat populaatioiden sisäistä geneettistä muuntelua ja näin ollen muuntelun pitäisi teoriassa ajan myötä hävitä populaatiosta. Tämä ei kuitenkaan toteudu luonnossa, vaan geneettinen muuntelu säilyy populaatioissa voimakkaastakin valinnasta huolimatta. Selitä, miten se on mahdollista. (3 pistettä)
  3. Eri fylogeneettiset analyysit käsittelevät DNA-piirteitä eri tavoin. Alla on viiden lajin 20:n emäksen pituiset sekvenssit linjattuina. Vastaa kysymyksiin 3a-f:

Laji 1 ACCGATGACCGTCGCTGTAG

Laji 2 ACCGATGGCCTTTGGTGTAA

Laji 3 ACCGATGACCGTCGCCGTAA

Laji 4 ACCAATCACCGTAGCTGTTA

Laji 5 AGCACTCACCCTATCTGTAA

  • Kuinka monta käyttökelpoista piirrettä kyseisessä linjauksessa on kladistisessa analyysissa (anna piirteiden numerot)?
  • Miksi näitä piirteitä kladistiikassa kutsutaan ja miten ne tarkemmin määritellään?
  • Jos linjauksesta lasketaan lajien väliset geneettiset etäisyydet, minkä lajiparin etäisyys on pienin, minkä suurin? Anna kyseiset lajiparit sekä niiden absoluuttiset geneettiset etäisyydet.
  • Mistä on kyse mallipohjaisissa fylogeneettisissa analyyseissa?
  • Mitä molekyylibiologista tietoa fylogeneettiset evoluutiomallit voivat sisältää?
  • Miten kyseinen molekyylibiologinen tieto saadaan?

resume writing services